Review



expression plasmid pcdna3 hl1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc expression plasmid pcdna3 hl1
    Expression Plasmid Pcdna3 Hl1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expression+plasmid+pcdna3+hl1/pcDNA3-hL1+(Plasmid+%2389411)/pm36843549-378-8-16
    Average 93 stars, based on 6 article reviews
    expression plasmid pcdna3 hl1 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: N-BAR and F-BAR proteins-endophilin-A3 and PSTPIP1-control clathrin-independent endocytosis of L1CAM.
    Article Snippet: .. Using PCR, we then amplified L1CAMΔRSLE from the expression plasmid pcDNA3-hL1 (Gift from Fritz - Rathjen, Addgene plasmid # 89411) (forward primer: 50- GGATCTGTACAGGCCTTAAGATGGTCGTGGCGCTGCGGTA-30; reverse primer: 50- TCACCATGGATCCGAATTCGCCTTCTAGGGCCACGGCAGG 30) and pIREShyg3-GFP (forward primer: 50-ACCCTGCCGTGGCCCTAGAAGG CGCGCTAGCGCTTCGAAG ACCCTGCCGTGGCCCTAGAAGGCGCG CTAGCGCTTCGAAG-30; reverse primer: 50- TACCGCAGCGCCACGACCATCTTAAGGCCTGTACAGATCC -30). .. The assembly of PCR fragments was performed according to the manufacturer's instructions (Gibson Assembly Master Mix, New England Biolabs, E2611S).

    Amplification:

    Article Title: N-BAR and F-BAR proteins-endophilin-A3 and PSTPIP1-control clathrin-independent endocytosis of L1CAM.
    Article Snippet: .. Using PCR, we then amplified L1CAMΔRSLE from the expression plasmid pcDNA3-hL1 (Gift from Fritz - Rathjen, Addgene plasmid # 89411) (forward primer: 50- GGATCTGTACAGGCCTTAAGATGGTCGTGGCGCTGCGGTA-30; reverse primer: 50- TCACCATGGATCCGAATTCGCCTTCTAGGGCCACGGCAGG 30) and pIREShyg3-GFP (forward primer: 50-ACCCTGCCGTGGCCCTAGAAGG CGCGCTAGCGCTTCGAAG ACCCTGCCGTGGCCCTAGAAGGCGCG CTAGCGCTTCGAAG-30; reverse primer: 50- TACCGCAGCGCCACGACCATCTTAAGGCCTGTACAGATCC -30). .. The assembly of PCR fragments was performed according to the manufacturer's instructions (Gibson Assembly Master Mix, New England Biolabs, E2611S).

    Expressing:

    Article Title: N-BAR and F-BAR proteins-endophilin-A3 and PSTPIP1-control clathrin-independent endocytosis of L1CAM.
    Article Snippet: .. Using PCR, we then amplified L1CAMΔRSLE from the expression plasmid pcDNA3-hL1 (Gift from Fritz - Rathjen, Addgene plasmid # 89411) (forward primer: 50- GGATCTGTACAGGCCTTAAGATGGTCGTGGCGCTGCGGTA-30; reverse primer: 50- TCACCATGGATCCGAATTCGCCTTCTAGGGCCACGGCAGG 30) and pIREShyg3-GFP (forward primer: 50-ACCCTGCCGTGGCCCTAGAAGG CGCGCTAGCGCTTCGAAG ACCCTGCCGTGGCCCTAGAAGGCGCG CTAGCGCTTCGAAG-30; reverse primer: 50- TACCGCAGCGCCACGACCATCTTAAGGCCTGTACAGATCC -30). .. The assembly of PCR fragments was performed according to the manufacturer's instructions (Gibson Assembly Master Mix, New England Biolabs, E2611S).

    Plasmid Preparation:

    Article Title: N-BAR and F-BAR proteins-endophilin-A3 and PSTPIP1-control clathrin-independent endocytosis of L1CAM.
    Article Snippet: .. Using PCR, we then amplified L1CAMΔRSLE from the expression plasmid pcDNA3-hL1 (Gift from Fritz - Rathjen, Addgene plasmid # 89411) (forward primer: 50- GGATCTGTACAGGCCTTAAGATGGTCGTGGCGCTGCGGTA-30; reverse primer: 50- TCACCATGGATCCGAATTCGCCTTCTAGGGCCACGGCAGG 30) and pIREShyg3-GFP (forward primer: 50-ACCCTGCCGTGGCCCTAGAAGG CGCGCTAGCGCTTCGAAG ACCCTGCCGTGGCCCTAGAAGGCGCG CTAGCGCTTCGAAG-30; reverse primer: 50- TACCGCAGCGCCACGACCATCTTAAGGCCTGTACAGATCC -30). .. The assembly of PCR fragments was performed according to the manufacturer's instructions (Gibson Assembly Master Mix, New England Biolabs, E2611S).



    Similar Products

    expression plasmid pcdna3 hl1  (Addgene inc)
    93
    Addgene inc expression plasmid pcdna3 hl1
    Expression Plasmid Pcdna3 Hl1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expression+plasmid+pcdna3+hl1/pcDNA3-hL1+(Plasmid+%2389411)/pm36843549-378-8-16
    Average 93 stars, based on 1 article reviews
    expression plasmid pcdna3 hl1 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results